Part:BBa_K1431814:Design
amajLime, yellow-green chromoprotein reporter system (Strong Promoter, Strong RBS)
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This Biobrick is constructed through 3 steps:
- Do double enzyme digestion (XbaI & PstI for BBa_K1033916, SpeI & PstI for BBa_B0034) and do gel extraction, ligation, transformation, picking up single colonies, LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Do double enzyme digestion (XbaI & PstI for Step 1 product, SpeI & PstI for J23100) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Cryopreserved the rest bacteria broth and send samples for sequencing.
Sequencing Result
We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.
Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc
The sequencing result was very interesting: compared with the sequence in Parts Registry, three point mutations were observed, one between NcoI and XbaI enzyme recognition site and two in BBa_J23100 sequence. The sequencing result for B0034 was completely inconsistent with the expected sequence. The following figure shows the detailed information.
We observed the similar sequencing result in BBa_K1431814 which is also made up of promoter BBa_J23100. We think this sequencing error may explain the unusual observation when comparing the expression with BBa_J23106 because these two mutations weaken the transcriptional strength of BBa_J23100.
Source
The following list is the Biobricks we've used in construction and their detailed design information.
| Part | Type | Discription | Backbone | Location on the plate |
|---|---|---|---|---|
| BBa_J23100 | Promoter | Strong Promoter | BBa_J61002 (Amp) | 17D 2014 Kit Plate 4 |
| BBa_J23106 | Promoter | Weak Promoter | BBa_J61002 (Amp) | 17P 2014 Kit Plate 4 |
| BBa_B0031 | RBS | Weak RBS | pSB1A2 | 1H 2014 Kit Plate 4 |
| BBa_B0034 | RBS | Strong RBS | pSB1A2 | 1N 2014 Kit Plate 4 |
| BBa_B0015 | Terminator | Strong terminator (B0010+B0012) | pSB1C3 | 3F 2014 Kit Plate 3 |
| BBa_K592009 | Chromoprotein | amilCP, blue chromoprotein | pSB1C3 | 19E 2014 Kit Plate 1 |
| BBa_K592011 | Chromoprotein | cjBlue, green chromoprotein | pSB1C3 | 2I 2014 Kit Plate 4 |
| BBa_K1033916 | Chromoprotein | amajLime, yellow-green chromoprote | pSB1C3 | 6M 2014 Kit Plate 4 |